Science & Mathematics

In two artificial language learning experiments with four groups of highly proficient Basque-Spanish bilinguals and two groups of Spanish monolinguals, we examine the cues that allow adult listeners to parse new input into phrases. In addition, we investigate which factors lead bilinguals to switch between the segmentation strategies characteristic of their two languages. We show that segmental information drives bilinguals’ choice of a segmentation strategy when presented with an unfamiliar language. The language in which bilinguals are addressed during the study (i.e., the language of context) additionally modulates their segmentation preference, and this context language effect is found in L1Basque bilinguals but does not extend to L1Spanish bilinguals. The cause of this asymmetry is yet to be established. Finally, we show that adult monolinguals disregard statistical cues in favor of unfamiliar segmental information when in conflict. These results evidence that the available phrase segmentation cues are arranged hierarchically.

(Uploaded by Plazi for the IPBES Invasive Alien Species Assessment) Terrestrial invasive plants are a global problem and are becoming ubiquitous components of most ecosystems. They are implicated in altering disturbance regimes, reducing biodiversity, and changing ecosystem function, sometimes in profound and irreversible ways. However, the ecological impacts of most invasive plants have not been studied experimentally, and most research to date focuses on few types of impacts, which can vary greatly among studies. Thus, our knowledge of existing ecological impacts ascribed to invasive plants is surprisingly limited in both breadth and depth. Our aim was to propose a standard methodology for quantifying baseline ecological impact that, in theory, is scalable to any terrestrial plant invader (e.g., annual grasses to trees) and any invaded system (e.g., grassland to forest). The Global Invader Impact Network (GIIN) is a coordinated distributed experiment composed of an observational and manipulative methodology. The protocol consists of a series of plots located in (1) an invaded area; (2) an adjacent removal treatment within the invaded area; and (3) a spatially separate uninvaded area thought to be similar to pre-invasion conditions of the invaded area. A standardized and inexpensive suite of community, soil, and ecosystem metrics are collected allowing broad comparisons among measurements, populations, and species. The method allows for one-time comparisons and for long-term monitoring enabling one to derive information about change due to invasion over time. Invader removal plots will also allow for quantification of legacy effects and their return rates, which will be monitored for several years. GIIN uses a nested hierarchical scale approach encompassing multiple sites, regions, and continents. Currently, GIIN has network members in six countries, with new members encouraged. To date, study species include representatives of annual and perennial grasses; annual and perennial forbs; shrubs; and trees. The goal of the GIIN framework is to create a standard yet flexible platform for understanding the ecological impacts of invasive plants, allowing both individual and synthetic analyses across a range of taxa and ecosystems. If broadly adopted, this standard approach will offer unique insight into the ecological impacts of invasive plants at local, regional, and global scales.

(Uploaded by Plazi for the IPBES Invasive Alien Species Assessment) Boring polychaetes infesting the shells of aquacultured molluscs affect host fitness and cause serious economic problems for the aquaculture industry. In Chile, knowledge of the native and non-indigenous polychaete fauna associated with mollusc hosts is limited, in spite of the fact that numerous native and nonindigenous mollusc species are actively harvested. We present the first complete list of boring polychaete species present in Chile, with a review of the information regarding each species' status as a native or nonindigenous species (NIS), together with information on native and introduced ranges, affected host species, likely vectors of introduction and donor areas. We recorded a total of nine boring polychaetes present along the Chilean coast including native and NIS. Within the NIS category we provide the first published report of the Sabellid Terebrasabella heterouncinata in South America. Boring polychaetes utilized both native and introduced host species. The finding of polychaete species which utilized multiple native and NIS hosts, indicates a potential risk for spread between aquaculture facilities and the natural environment. Our analysis suggests that aquaculture activities are probably the primary introduction vector for boring polychaete species to Chile and that this region does not differ in the magnitude of introduced boring polychaetes relative to other regions of the world. We discuss current laws and management regarding polychaete infestations and make recommendations for future management in Chile, which should contemplate a rational compromise between the socio-economic needs of the country and plans to protect and preserve the nation's biodiversity.

Erebia (Erebia) pawloskii bilibinia Grishin, new subspecieshttp://zoobank.org/ 79EA8344-F03A-4D4C-A7D4-F3095814D506(Figs. 3 part, 4)Definition and diagnosis. Genomic analysis of Erebia (Erebia) pawloskii Ménétriés, 1859 (type locality in Russia: Sakha) specimens reveals a clade of a pair from Chukotka, Russia, not monophyletic with any represents a new subspecies. It differs by smaller orange and cream spots than in most other subspecies (except the two mentioned next), the spots are vestigial in the posterior 2/3 rd of the hindwing of a male, but larger ventral hindwing cream spots than in Erebia pawloskii alaskensis W. Holland, 1900 (type locality in USA: Alaska) and Erebia pawloskii canadensis B. Warren, 1931 (type locality in Canada: Manitoba). Due to unexplored individual variation in this subspecies, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: hm2021401- RA.2:C36T, hm2021401-RA.2:T87C, hm2004829-RA.3:C54T, hm2007306-RA.8:A114G, hm2018041- RA.1:A456G. However, this taxon does not differ from other subspecies and even related species in the COI barcode because the mitochondrial genome seems to introgress among the relatives (Fig. 3b).Barcode sequence of the holotype. Sample NVG-24041B06, GenBank PV549978, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACATCTCTCAGTTTAATTATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGTAATTGACTTATTCCTATTATATTAGGAGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGACTCCTTCCCCCCTCTTTAATTTTATTAATTTCAAGTAGTATTGTAGAAAATGGTGCTGGTACAGGATGAACGGTTTATCCCCCCCTTTCATCTAATATTGC TCACAGTGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGTATATCT TATGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTCTCTCTACCTGTATTAGCTGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAACACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTTType material. Holotype: ♂ deposited in the Staatliches Museum für Naturkunde, Stuttgart, Germany (SMNS), illustrated in Fig. 4a, bears the following four printed rectangular labels, three white: [Russland, E.-Sibiria | Chukotka, Bilibino | VII. 1993 | leg. Karpov], [ex coll. W. Eckweiler | SMNS-Lep. 2005 – 07], [DNA sample ID: | NVG-24041B06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Erebia pawloskii | bilibinia Grishin]. Paratype: 1♀ NVG-24041B07 the same data as the holotype (Fig. 4b).Type locality. Russia: Chukotka, Bilibino.Etymology. The name is given for the type locality and is treated as a feminine noun in apposition.Distribution. Currently known only from Chukotka in Russia.

A short biography of Kwang-So Francis Chang, a Chinese entomologist, anatomist and educator, is presented. His contributions to entomology included introducing 26 species and subspecies and three genera of Orthoptera from China. Each of these names is listed with the original bibliographic reference, the type locality and current status. A table lists the geographic names used by K. S. F. Chang with the corresponding modern names.

पर्यटन हा आधुनिक काळातील वेगाने विकसित होणारा उद्योग असून तो स्थानिक विकासाशी घनिष्ठपणे जोडलेला आहे. पर्यटनामुळे केवळ आर्थिक उत्पन्नात वाढ होत नाही तर स्थानिक समाजाच्या सामाजिक, सांस्कृतिक व पायाभूत विकासालाही चालना मिळते. भारतासारख्या विकसनशील देशात नैसर्गिक सौंदर्य, ऐतिहासिक वारसा, धार्मिक स्थळे व सांस्कृतिक विविधता यांमुळे पर्यटन उद्योगाला विशेष महत्त्व प्राप्त झाले आहे. या संशोधन लेखामध्ये पर्यटन आणि स्थानिक विकास यांतील परस्परसंबंधांचा सविस्तर अभ्यास करण्यात आला आहे. पर्यटनामुळे रोजगारनिर्मिती, स्थानिक उत्पन्नात वाढ, पायाभूत सुविधांचा विकास, ग्रामीण व दुर्गम भागांचा विकास, महिला सक्षमीकरण, कौशल्य विकास तसेच सांस्कृतिक जतन व संवर्धन यासारखे सकारात्मक परिणाम दिसून येतात. त्याचबरोबर अति-पर्यटन, पर्यावरणीय ऱ्हास, आर्थिक असमानता, स्थानिक संस्कृतीवरील नकारात्मक परिणाम आणि पायाभूत सुविधांवरील ताण यांसारख्या समस्याही उद्भवतात. म्हणूनच पर्यटन विकासासाठी शाश्वत दृष्टिकोन, योग्य नियोजन, पर्यावरण संरक्षण आणि स्थानिक लोकांचा सक्रिय सहभाग अत्यावश्यक आहे. शाश्वत पर्यटनाच्या माध्यमातून स्थानिक विकास साध्य करून आर्थिक समृद्धी, सामाजिक प्रगती आणि सांस्कृतिक संवर्धन यांचा समतोल राखता येऊ शकतो, असा निष्कर्ष या अभ्यासातून मांडण्यात आला आहे.

Today, efforts are being made to understand water and its problems, the growing demand for water and the underlying causes of water resource depletion. The main issue is the rational and efficient use of water, aimed at improving the reclamation of irrigated lands. Basically, the reforms carried out in our country in the last 5-6 years have shown their positive effect in the water sector, the use of water-saving technologies, and the tasks being solved in this regard will expand the scope of application of water-saving technologies. will be introduced in the future, will allow for a significant increase. Uzbekistan is also implementing important measures related to the rational use of water resources.

Abstract Academic achievement is a multifaceted phenomenon influenced by a variety of internal and external variables. In the Nigerian educational context, there is a growing concern regarding the declining performance of students relative to social expectations. This study investigated the impact of two critical external determinants: teaching strategies employed by educators and the nature of support provided by parents.The study adopted a survey research design. The population consisted of 910 Junior Secondary School Year 2 (JSS2) students across seven public secondary schools in Egbeda Local Government Area, Oyo State. Using the Taro Yamane formula and cluster sampling, a sample size of 278 students was selected. Data were collected using a structured 5-point Likert scale questionnaire, which demonstrated high reliability (Cronbach’s alpha coefficients: Teaching Strategies = 0.82; Parental Support = 0.79). Objective academic performance data in Basic Science were obtained from school records. Data were analyzed using descriptive statistics (frequency, mean, and standard deviation) and one-way within-subjects ANOVA via SPSS. The findings revealed a significant main effect of teaching strategies on student academic achievement (F(2.329,659.114)=58.032,p<.0005,ηp2=.170). Peer teaching (M=20.87) and problem-based teaching (M=20.23) were found to be more effective than direct instruction (M=19.57) and project-based teaching (M=18.94). Furthermore, parental support significantly influenced achievement (F(2.725,771.184)=45.757,p<.0005,ηp2=.139). Specifically, parental monitoring (M=19.12) and home-based involvement (M=18.15) yielded higher academic mean scores compared to parental communication (M=17.25) and school-based involvement (M=16.89). The study concludes that innovative, student-centered teaching methodologies and active at-home parental monitoring are superior predictors of academic success compared to traditional lecture-based methods and passive school-based parental participation.

PetVision newsletter, 3rd edition

Instability in verification facilities used for gas meter calibration arises from multiple physical and metrological factors, including pressure and temperature fluctuations, flow pulsations, gas compressibility and composition changes, hydraulic regime variations in pipelines, sensor drift, regulator dynamics, and reference channel uncertainties.

Business process intelligence improves operational efficiency that is essential for achieving business objectives, besides facilitating competitive advantage. As organizations operate through inter-connected business processes, insights into their process performance through related business rules are essential to achieve business objectives. This paper outlines an approach for developing insight-driven business rules using the concept of buckets, which can lead to the development of a repository of business knowledge for business process operations.

In urban Democratic Republic of the Congo, a considerable proportion of maternal healthcare is delivered by informal providers, such as traditional birth attendants, medicine vendors, and unlicensed practitioners. The effect of this reliance on maternal health outcomes is not well understood, with existing evidence being fragmented. This meta-analysis aimed to synthesise quantitative and qualitative evidence on the relationship between informal healthcare provision and key maternal health outcomes in urban DRC. Its objectives were to quantify the prevalence of use and to identify associated health impacts. A systematic review and meta-analysis was conducted. Multiple electronic databases were searched for relevant studies. Inclusion criteria encompassed observational and qualitative studies reporting on informal sector use and maternal outcomes. Quantitative data were pooled using random-effects models; thematic synthesis was employed for qualitative findings. The analysis indicated that informal providers attend a substantial proportion of urban births, with a pooled estimated prevalence of approximately 40%. Their involvement was associated with both positive and negative outcomes. Reported benefits included improved accessibility and cultural concordance. Negative associations included higher rates of delayed referral for obstetric complications and suboptimal management of postpartum haemorrhage. Informal healthcare providers fill a critical gap in the formal health system, yet their role presents a complex duality for maternal health. While improving access, unregulated practice can contribute to adverse outcomes, underscoring a significant public health challenge. Policymakers should develop regulatory frameworks focusing on training, formal linkage with the health system, and clear referral pathways for informal providers. Future research should evaluate intervention models that integrate and supervise these providers to improve safety. maternal health, informal health sector, urban health, Democratic Republic of the Congo, meta-analysis, traditional birth attendants This study provides the first comprehensive quantitative synthesis on the prevalence and maternal health impacts of informal healthcare provision in urban DRC, offering consolidated evidence for policy and practice.

Research Background: Adjustment, life skills, and family composition are closely interconnected in adolescent development. A supportive family composition, whether nuclear or joint, provides the emotional, social, and cognitive environment that influences how adolescents adjust to life challenges. That way in this study, find out the impact of emotional intelligence and educational medium on academic anxiety of the adolescents. Objectives: The study objective was to find out the effect of level of adjustment on life skills of adolescents. Another objective was to examine the effect of family composition on life skills of adolescents. Further, the objective was to study the significant interaction effect between level of adjustment and family composition on the life skills of adolescents. Procedure: The study one hundred sixty adolescent were selected from the society. Out of them, eighty adolescents were selected from batter adjustment level, and same way, eighty adolescents were selected from poor adjustment level. The purposive sampling technique has been used for the selection of the samples. The study adjustment and family composition were independent variables and life skills was dependent variable. The study Adjustment Inventory developed by P. Kumar and Life Skills Scale by Chandra Kumari and Ayushi Tripathi has been used. Conclusions: It can be concluded that adolescents of better adjustment found excellent life skills than adolescents of poor adjustment. Adolescents of joint family composition and nuclear family composition show equal on their life skills. Additionally, no significant interaction effect was found between adjustment and family composition on the life skills of adolescents.

Ushbu maqolada falsafa fanining shakllanishi va rivojlanish bosqichlari, inson tafakkuri va jamiyat taraqqiyotidagi o‘rni tahlil qilinadi. Shuningdek, falsafaning inson hayotiga ijtimoiy, ma’naviy va axloqiy ta’siri yoritilib, uni zamonaviy sharoitda takomillashtirish omillari ko‘rib chiqiladi. Maqola yosh avlodda tanqidiy fikrlashni shakllantirishda falsafaning ahamiyatini ochib beradi.